| p-value: | 1e-61 |
| log p-value: | -1.407e+02 |
| Information Content per bp: | 1.891 |
| Number of Target Sequences with motif | 505.0 |
| Percentage of Target Sequences with motif | 1.63% |
| Number of Background Sequences with motif | 180.7 |
| Percentage of Background Sequences with motif | 0.71% |
| Average Position of motif in Targets | 25.3 +/- 12.5bp |
| Average Position of motif in Background | 24.6 +/- 12.2bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
Gata1(Zf)/K562-GATA1-ChIP-Seq(GSE18829)/Homer
| Match Rank: | 1 |
| Score: | 0.98 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CAGATAAG-- CAGATAAGGN |
|

|
|
Gata2(Zf)/K562-GATA2-ChIP-Seq(GSE18829)/Homer
| Match Rank: | 2 |
| Score: | 0.97 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CAGATAAG-- NAGATAAGNN |
|

|
|
MA0482.1_Gata4/Jaspar
| Match Rank: | 3 |
| Score: | 0.96 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CAGATAAG- NNGAGATAAGA |
|

|
|
MA0035.3_Gata1/Jaspar
| Match Rank: | 4 |
| Score: | 0.96 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CAGATAAG-- ANAGATAAGAA |
|

|
|
MA0037.2_GATA3/Jaspar
| Match Rank: | 5 |
| Score: | 0.94 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CAGATAAG- -AGATAAGA |
|

|
|
Gata4(Zf)/Heart-Gata4-ChIP-Seq(GSE35151)/Homer
| Match Rank: | 6 |
| Score: | 0.94 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CAGATAAG- NBWGATAAGR |
|

|
|
MA0036.2_GATA2/Jaspar
| Match Rank: | 7 |
| Score: | 0.93 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CAGATAAG----- NCAGATAAGAANNN |
|

|
|
PB0023.1_Gata6_1/Jaspar
| Match Rank: | 8 |
| Score: | 0.90 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----CAGATAAG----- TATAGAGATAAGAATTG |
|

|
|
GATA3(Zf)/iTreg-Gata3-ChIP-Seq(GSE20898)/Homer
| Match Rank: | 9 |
| Score: | 0.89 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | CAGATAAG- -AGATAASR |
|

|
|
PB0021.1_Gata3_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.87 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------CAGATAAG-------- TTTTTAGAGATAAGAAATAAAG |
|

|
|