| p-value: | 1e-210 |
| log p-value: | -4.837e+02 |
| Information Content per bp: | 1.927 |
| Number of Target Sequences with motif | 398.0 |
| Percentage of Target Sequences with motif | 0.77% |
| Number of Background Sequences with motif | 26.2 |
| Percentage of Background Sequences with motif | 0.10% |
| Average Position of motif in Targets | 93.7 +/- 49.0bp |
| Average Position of motif in Background | 109.5 +/- 58.6bp |
| Strand Bias (log2 ratio + to - strand density) | 0.2 |
| Multiplicity (# of sites on avg that occur together) | 1.00 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
PB0011.1_Ehf_1/Jaspar
| Match Rank: | 1 |
| Score: | 0.64 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --AACGCGGA----- AGGACCCGGAAGTAA |
|

|
|
MA0006.1_Arnt::Ahr/Jaspar
| Match Rank: | 2 |
| Score: | 0.62 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | AACGCGGA CACGCA-- |
|

|
|
PB0199.1_Zfp161_2/Jaspar
| Match Rank: | 3 |
| Score: | 0.61 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AACGCGGA------ GCCGCGCAGTGCGT |
|

|
|
PB0024.1_Gcm1_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.61 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---AACGCGGA----- TCGTACCCGCATCATT |
|

|
|
ELF5(ETS)/T47D-ELF5-ChIP-Seq(GSE30407)/Homer
| Match Rank: | 5 |
| Score: | 0.59 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | AACGCGGA--- -ACVAGGAAGT |
|

|
|
PB0077.1_Spdef_1/Jaspar
| Match Rank: | 6 |
| Score: | 0.59 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---AACGCGGA----- AANNATCCGGATGTNN |
|

|
|
PB0012.1_Elf3_1/Jaspar
| Match Rank: | 7 |
| Score: | 0.59 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | AACGCGGA----- AACAAGGAAGTAA |
|

|
|
ELF1(ETS)/Jurkat-ELF1-ChIP-Seq(SRA014231)/Homer
| Match Rank: | 8 |
| Score: | 0.58 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | AACGCGGA--- -ANCCGGAAGT |
|

|
|
PB0111.1_Bhlhb2_2/Jaspar
| Match Rank: | 9 |
| Score: | 0.58 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------AACGCGGA------- TGTCATTACACGTGGAAGGCGGT |
|

|
|
MA0131.1_HINFP/Jaspar
| Match Rank: | 10 |
| Score: | 0.57 |
| Offset: | 3 |
| Orientation: | reverse strand |
| Alignment: | AACGCGGA----- ---GCGGACGTTN |
|

|
|