| p-value: | 1e-11 |
| log p-value: | -2.694e+01 |
| Information Content per bp: | 1.928 |
| Number of Target Sequences with motif | 101.0 |
| Percentage of Target Sequences with motif | 1.83% |
| Number of Background Sequences with motif | 370.7 |
| Percentage of Background Sequences with motif | 0.84% |
| Average Position of motif in Targets | 98.7 +/- 49.3bp |
| Average Position of motif in Background | 87.5 +/- 55.1bp |
| Strand Bias (log2 ratio + to - strand density) | -0.2 |
| Multiplicity (# of sites on avg that occur together) | 1.02 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
USF1(HLH)/GM12878-Usf1-ChIP-Seq(GSE32465)/Homer
| Match Rank: | 1 |
| Score: | 0.94 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CACGTGAC- TCACGTGACC |
|

|
|
Usf2(HLH)/C2C12-Usf2-ChIP-Seq(GSE36030)/Homer
| Match Rank: | 2 |
| Score: | 0.94 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CACGTGAC ACCACGTGAC |
|

|
|
MA0093.2_USF1/Jaspar
| Match Rank: | 3 |
| Score: | 0.94 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CACGTGAC- GCCACGTGACC |
|

|
|
CLOCK(HLH)/Liver-Clock-ChIP-Seq(GSE39860)/Homer
| Match Rank: | 4 |
| Score: | 0.93 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CACGTGAC CACGTGDC |
|

|
|
E-box(HLH)/Promoter/Homer
| Match Rank: | 5 |
| Score: | 0.92 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CACGTGAC--- TCACGTGACCGG |
|

|
|
BMAL1(HLH)/Liver-Bmal1-ChIP-Seq(GSE39860)/Homer
| Match Rank: | 6 |
| Score: | 0.92 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CACGTGAC CACGTGNC |
|

|
|
NPAS2(HLH)/Liver-NPAS2-ChIP-Seq(GSE39860)/Homer
| Match Rank: | 7 |
| Score: | 0.91 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CACGTGAC KCCACGTGAC |
|

|
|
bHLHE40(HLH)/HepG2-BHLHE40-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 8 |
| Score: | 0.91 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CACGTGAC- KCACGTGMCN |
|

|
|
PB0007.1_Bhlhb2_1/Jaspar
| Match Rank: | 9 |
| Score: | 0.90 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CACGTGAC------ GGAAGAGTCACGTGACCAATAC |
|

|
|
MA0526.1_USF2/Jaspar
| Match Rank: | 10 |
| Score: | 0.89 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CACGTGAC- GTCATGTGACC |
|

|
|