| p-value: | 1e-79 |
| log p-value: | -1.836e+02 |
| Information Content per bp: | 1.850 |
| Number of Target Sequences with motif | 109.0 |
| Percentage of Target Sequences with motif | 2.86% |
| Number of Background Sequences with motif | 5.6 |
| Percentage of Background Sequences with motif | 0.25% |
| Average Position of motif in Targets | 103.9 +/- 48.8bp |
| Average Position of motif in Background | 130.8 +/- 24.9bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.02 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
PB0112.1_E2F2_2/Jaspar
| Match Rank: | 1 |
| Score: | 0.65 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----GTWGCGRC----- NNNNTTGGCGCCGANNN |
|

|
|
PB0113.1_E2F3_2/Jaspar
| Match Rank: | 2 |
| Score: | 0.65 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----GTWGCGRC----- NNNNTTGGCGCCGANNN |
|

|
|
CEBP:AP1(bZIP)/ThioMac-CEBPb-ChIP-Seq(GSE21512)/Homer
| Match Rank: | 3 |
| Score: | 0.61 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | GTWGCGRC--- -TTGCAACATN |
|

|
|
PB0055.1_Rfx4_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.57 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----GTWGCGRC--- TACCATAGCAACGGT |
|

|
|
PB0056.1_Rfxdc2_1/Jaspar
| Match Rank: | 5 |
| Score: | 0.57 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----GTWGCGRC--- CCGCATAGCAACGGA |
|

|
|
PB0054.1_Rfx3_1/Jaspar
| Match Rank: | 6 |
| Score: | 0.57 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------GTWGCGRC------- TGTGACCCTTAGCAACCGATTAA |
|

|
|
YY1(Zf)/Promoter/Homer
| Match Rank: | 7 |
| Score: | 0.56 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----GTWGCGRC CAAGATGGCGGC |
|

|
|
Elk1(ETS)/Hela-Elk1-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 8 |
| Score: | 0.55 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --GTWGCGRC HACTTCCGGY |
|

|
|
PB0036.1_Irf6_1/Jaspar
| Match Rank: | 9 |
| Score: | 0.55 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------GTWGCGRC--- NNNTTGGTTTCGNTNNN |
|

|
|
Rfx5(HTH)/GM12878-Rfx5-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 10 |
| Score: | 0.55 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --GTWGCGRC-- SCCTAGCAACAG |
|

|
|