| p-value: | 1e-66 |
| log p-value: | -1.524e+02 |
| Information Content per bp: | 1.810 |
| Number of Target Sequences with motif | 206.0 |
| Percentage of Target Sequences with motif | 5.40% |
| Number of Background Sequences with motif | 28.3 |
| Percentage of Background Sequences with motif | 1.24% |
| Average Position of motif in Targets | 100.3 +/- 53.7bp |
| Average Position of motif in Background | 95.4 +/- 57.4bp |
| Strand Bias (log2 ratio + to - strand density) | 0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.09 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
MF0002.1_bZIP_CREB/G-box-like_subclass/Jaspar
| Match Rank: | 1 |
| Score: | 0.85 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | CACGTCAC -ACGTCA- |
|

|
|
CRE(bZIP)/Promoter/Homer
| Match Rank: | 2 |
| Score: | 0.82 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----CACGTCAC CGGTGACGTCAC |
|

|
|
MA0093.2_USF1/Jaspar
| Match Rank: | 3 |
| Score: | 0.82 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CACGTCAC- GCCACGTGACC |
|

|
|
E-box(HLH)/Promoter/Homer
| Match Rank: | 4 |
| Score: | 0.80 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CACGTCAC--- TCACGTGACCGG |
|

|
|
USF1(HLH)/GM12878-Usf1-ChIP-Seq(GSE32465)/Homer
| Match Rank: | 5 |
| Score: | 0.79 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CACGTCAC- TCACGTGACC |
|

|
|
MA0018.2_CREB1/Jaspar
| Match Rank: | 6 |
| Score: | 0.78 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CACGTCAC TGACGTCA- |
|

|
|
Usf2(HLH)/C2C12-Usf2-ChIP-Seq(GSE36030)/Homer
| Match Rank: | 7 |
| Score: | 0.77 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CACGTCAC ACCACGTGAC |
|

|
|
MA0526.1_USF2/Jaspar
| Match Rank: | 8 |
| Score: | 0.77 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CACGTCAC- GTCATGTGACC |
|

|
|
CLOCK(HLH)/Liver-Clock-ChIP-Seq(GSE39860)/Homer
| Match Rank: | 9 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CACGTCAC CACGTGDC |
|

|
|
PB0007.1_Bhlhb2_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.76 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CACGTCAC------ GGAAGAGTCACGTGACCAATAC |
|

|
|