| p-value: | 1e-3 |
| log p-value: | -7.177e+00 |
| Information Content per bp: | 1.640 |
| Number of Target Sequences with motif | 1307.0 |
| Percentage of Target Sequences with motif | 18.63% |
| Number of Background Sequences with motif | 3119.9 |
| Percentage of Background Sequences with motif | 17.19% |
| Average Position of motif in Targets | 411.4 +/- 377.5bp |
| Average Position of motif in Background | 457.7 +/- 430.4bp |
| Strand Bias (log2 ratio + to - strand density) | -0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.19 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
PB0132.1_Hbp1_2/Jaspar
| Match Rank: | 1 |
| Score: | 0.79 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------CAATWGGA--- NNTNNACAATGGGANNN |
|

|
|
MA0077.1_SOX9/Jaspar
| Match Rank: | 2 |
| Score: | 0.76 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CAATWGGA GAACAATGG-- |
|

|
|
NFY(CCAAT)/Promoter/Homer
| Match Rank: | 3 |
| Score: | 0.75 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CAATWGGA AGCCAATCGG- |
|

|
|
MA0078.1_Sox17/Jaspar
| Match Rank: | 4 |
| Score: | 0.70 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --CAATWGGA GACAATGNN- |
|

|
|
PB0183.1_Sry_2/Jaspar
| Match Rank: | 5 |
| Score: | 0.69 |
| Offset: | -8 |
| Orientation: | forward strand |
| Alignment: | --------CAATWGGA- TCACGGAACAATAGGTG |
|

|
|
Sox2(HMG)/mES-Sox2-ChIP-Seq(GSE11431)/Homer
| Match Rank: | 6 |
| Score: | 0.69 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---CAATWGGA GAACAATGGN- |
|

|
|
PB0173.1_Sox21_2/Jaspar
| Match Rank: | 7 |
| Score: | 0.69 |
| Offset: | -8 |
| Orientation: | reverse strand |
| Alignment: | --------CAATWGGA- NNNNNGAACAATTGANN |
|

|
|
PB0065.1_Sox15_1/Jaspar
| Match Rank: | 8 |
| Score: | 0.68 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CAATWGGA-- TAGTGAACAATAGATTT |
|

|
|
PB0070.1_Sox30_1/Jaspar
| Match Rank: | 9 |
| Score: | 0.68 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------CAATWGGA-- AATGAACAATGGAATT |
|

|
|
PB0073.1_Sox7_1/Jaspar
| Match Rank: | 10 |
| Score: | 0.67 |
| Offset: | -9 |
| Orientation: | forward strand |
| Alignment: | ---------CAATWGGA----- AATAAAGAACAATAGAATTTCA |
|

|
|