| p-value: | 1e-16 |
| log p-value: | -3.809e+01 |
| Information Content per bp: | 1.530 |
| Number of Target Sequences with motif | 33.0 |
| Percentage of Target Sequences with motif | 10.82% |
| Number of Background Sequences with motif | 3.6 |
| Percentage of Background Sequences with motif | 1.96% |
| Average Position of motif in Targets | 431.6 +/- 376.2bp |
| Average Position of motif in Background | 485.4 +/- 292.6bp |
| Strand Bias (log2 ratio + to - strand density) | 0.1 |
| Multiplicity (# of sites on avg that occur together) | 1.12 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
MA0006.1_Arnt::Ahr/Jaspar
| Match Rank: | 1 |
| Score: | 0.80 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | ATCGCGTG --TGCGTG |
|

|
|
Arnt:Ahr(bHLH)/MCF7-Arnt-ChIP-Seq(Lo et al.)/Homer
| Match Rank: | 2 |
| Score: | 0.73 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | ATCGCGTG--- -TTGCGTGCVA |
|

|
|
Usf2(HLH)/C2C12-Usf2-ChIP-Seq(GSE36030)/Homer
| Match Rank: | 3 |
| Score: | 0.72 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | ATCGCGTG-- GTCACGTGGT |
|

|
|
PB0147.1_Max_2/Jaspar
| Match Rank: | 4 |
| Score: | 0.72 |
| Offset: | -2 |
| Orientation: | reverse strand |
| Alignment: | --ATCGCGTG---- NNGTCGCGTGNCAC |
|

|
|
MF0007.1_bHLH(zip)_class/Jaspar
| Match Rank: | 5 |
| Score: | 0.70 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | ATCGCGTG ACCACGTG |
|

|
|
USF1(HLH)/GM12878-Usf1-ChIP-Seq(GSE32465)/Homer
| Match Rank: | 6 |
| Score: | 0.68 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -ATCGCGTG- GGTCACGTGA |
|

|
|
MA0004.1_Arnt/Jaspar
| Match Rank: | 7 |
| Score: | 0.68 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | ATCGCGTG --CACGTG |
|

|
|
c-Myc(HLH)/LNCAP-cMyc-ChIP-Seq(unpublished)/Homer
| Match Rank: | 8 |
| Score: | 0.67 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | ATCGCGTG-- --CACGTGGN |
|

|
|
PB0007.1_Bhlhb2_1/Jaspar
| Match Rank: | 9 |
| Score: | 0.67 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------ATCGCGTG-------- GGAAGAGTCACGTGACCAATAC |
|

|
|
bHLHE40(HLH)/HepG2-BHLHE40-ChIP-Seq(GSE31477)/Homer
| Match Rank: | 10 |
| Score: | 0.67 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -ATCGCGTG- NGKCACGTGM |
|

|
|