| p-value: | 1e-20 |
| log p-value: | -4.672e+01 |
| Information Content per bp: | 1.719 |
| Number of Target Sequences with motif | 23.0 |
| Percentage of Target Sequences with motif | 30.26% |
| Number of Background Sequences with motif | 2.2 |
| Percentage of Background Sequences with motif | 2.23% |
| Average Position of motif in Targets | 105.8 +/- 49.9bp |
| Average Position of motif in Background | 79.1 +/- 22.4bp |
| Strand Bias (log2 ratio + to - strand density) | 0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.05 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
PB0036.1_Irf6_1/Jaspar
| Match Rank: | 1 |
| Score: | 0.61 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------GATCCTAR--- CTGATCGAAACCAAAGT |
|

|
|
PB0181.1_Spdef_2/Jaspar
| Match Rank: | 2 |
| Score: | 0.60 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----GATCCTAR--- GATAACATCCTAGTAG |
|

|
|
PB0037.1_Isgf3g_1/Jaspar
| Match Rank: | 3 |
| Score: | 0.59 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------GATCCTAR CAAAATCGAAACTAA |
|

|
|
PH0017.1_Cux1_2/Jaspar
| Match Rank: | 4 |
| Score: | 0.59 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----GATCCTAR--- TAGTGATCATCATTA |
|

|
|
PB0035.1_Irf5_1/Jaspar
| Match Rank: | 5 |
| Score: | 0.58 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------GATCCTAR ATAAACCGAAACCAA |
|

|
|
IRF4(IRF)/GM12878-IRF4-ChIP-Seq(GSE32465)/Homer
| Match Rank: | 6 |
| Score: | 0.57 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GATCCTAR ACTGAAACCA- |
|

|
|
PB0034.1_Irf4_1/Jaspar
| Match Rank: | 7 |
| Score: | 0.56 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------GATCCTAR- CGTATCGAAACCAAA |
|

|
|
PRDM9(Zf)/Testis-DMC1-ChIP-Seq(GSE35498)/Homer
| Match Rank: | 8 |
| Score: | 0.55 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -GATCCTAR------ AGATGCTRCTRCCHT |
|

|
|
PB0125.1_Gata3_2/Jaspar
| Match Rank: | 9 |
| Score: | 0.54 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------GATCCTAR------- TTTTGTAGATTTTATCGACTTA |
|

|
|
HNF6(Homeobox)/Liver-Hnf6-ChIP-Seq(ERP000394)/Homer
| Match Rank: | 10 |
| Score: | 0.53 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----GATCCTAR NTATYGATCH--- |
|

|
|