| p-value: | 1e-14 |
| log p-value: | -3.348e+01 |
| Information Content per bp: | 1.443 |
| Number of Target Sequences with motif | 23.0 |
| Percentage of Target Sequences with motif | 53.49% |
| Number of Background Sequences with motif | 3.5 |
| Percentage of Background Sequences with motif | 8.73% |
| Average Position of motif in Targets | 116.3 +/- 74.6bp |
| Average Position of motif in Background | 138.5 +/- 64.7bp |
| Strand Bias (log2 ratio + to - strand density) | 0.4 |
| Multiplicity (# of sites on avg that occur together) | 1.43 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
Nr5a2(NR)/mES-Nr5a2-ChIP-Seq(GSE19019)/Homer
| Match Rank: | 1 |
| Score: | 0.63 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----CTTGRWYA TGACCTTGAN-- |
|

|
|
Nr5a2(NR)/Pancreas-LRH1-ChIP-Seq(GSE34295)/Homer
| Match Rank: | 2 |
| Score: | 0.61 |
| Offset: | -4 |
| Orientation: | reverse strand |
| Alignment: | ----CTTGRWYA TGACCTTGAV-- |
|

|
|
PB0158.1_Rfx3_2/Jaspar
| Match Rank: | 3 |
| Score: | 0.60 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CTTGRWYA-------- ACTGACCCTTGGTTACCACAAAG |
|

|
|
PB0014.1_Esrra_1/Jaspar
| Match Rank: | 4 |
| Score: | 0.59 |
| Offset: | -9 |
| Orientation: | reverse strand |
| Alignment: | ---------CTTGRWYA NNNNATGACCTTGANTN |
|

|
|
MA0505.1_Nr5a2/Jaspar
| Match Rank: | 5 |
| Score: | 0.58 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------CTTGRWYA- GCTGACCTTGAACTN |
|

|
|
PH0111.1_Nkx2-2/Jaspar
| Match Rank: | 6 |
| Score: | 0.57 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CTTGRWYA-- ATAACCACTTGAAAATT |
|

|
|
TATA-Box(TBP)/Promoter/Homer
| Match Rank: | 7 |
| Score: | 0.57 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CTTGRWYA--- CCTTTTATAGNC |
|

|
|
PB0159.1_Rfx4_2/Jaspar
| Match Rank: | 8 |
| Score: | 0.56 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CTTGRWYA---- TACCCTAGTTACCGA |
|

|
|
POL008.1_DCE_S_I/Jaspar
| Match Rank: | 9 |
| Score: | 0.56 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -CTTGRWYA GCTTCC--- |
|

|
|
PH0113.1_Nkx2-4/Jaspar
| Match Rank: | 10 |
| Score: | 0.56 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CTTGRWYA- TAAGCCACTTGAAATT |
|

|
|