| p-value: | 1e-19 |
| log p-value: | -4.480e+01 |
| Information Content per bp: | 1.787 |
| Number of Target Sequences with motif | 19.0 |
| Percentage of Target Sequences with motif | 14.39% |
| Number of Background Sequences with motif | 0.0 |
| Percentage of Background Sequences with motif | 0.00% |
| Average Position of motif in Targets | 179.5 +/- 87.7bp |
| Average Position of motif in Background | 0.0 +/- 0.0bp |
| Strand Bias (log2 ratio + to - strand density) | 0.3 |
| Multiplicity (# of sites on avg that occur together) | 1.05 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
MA0408.1_TOS8/Jaspar
| Match Rank: | 1 |
| Score: | 0.73 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --GTCAATCC CTGTCAAA-- |
|

|
|
MA0434.1_YPR013C/Jaspar
| Match Rank: | 2 |
| Score: | 0.73 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GTCAATCC TGTAGATCA |
|

|
|
Ptx1/dmmpmm(Noyes_hd)/fly
| Match Rank: | 3 |
| Score: | 0.71 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GTCAATCC- NGTTAATCCC |
|

|
|
MA0435.1_YPR015C/Jaspar
| Match Rank: | 4 |
| Score: | 0.71 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------GTCAATCC----- TGAAGACGTAAATCCTTACA |
|

|
|
ASH1/Literature(Harbison)/Yeast
| Match Rank: | 5 |
| Score: | 0.70 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -GTCAATCC AGTCAA--- |
|

|
|
PH0123.1_Obox3/Jaspar
| Match Rank: | 6 |
| Score: | 0.70 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---GTCAATCC------ ATAGTTAATCCCCCNNA |
|

|
|
bcd/dmmpmm(Noyes_hd)/fly
| Match Rank: | 7 |
| Score: | 0.70 |
| Offset: | -1 |
| Orientation: | forward strand |
| Alignment: | -GTCAATCC- GGTTAATCCN |
|

|
|
PH0137.1_Pitx1/Jaspar
| Match Rank: | 8 |
| Score: | 0.69 |
| Offset: | -3 |
| Orientation: | reverse strand |
| Alignment: | ---GTCAATCC------ NTTGTTAATCCCTCTNN |
|

|
|
MA0201.1_Ptx1/Jaspar
| Match Rank: | 9 |
| Score: | 0.69 |
| Offset: | 1 |
| Orientation: | forward strand |
| Alignment: | GTCAATCC -TTAATCC |
|

|
|
Pbx3(Homeobox)/GM12878-PBX3-ChIP-Seq(GSE32465)/Homer
| Match Rank: | 10 |
| Score: | 0.69 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---GTCAATCC- NCTGTCAATCAN |
|

|
|