| p-value: | 1e-15 |
| log p-value: | -3.657e+01 |
| Information Content per bp: | 1.758 |
| Number of Target Sequences with motif | 28.0 |
| Percentage of Target Sequences with motif | 14.74% |
| Number of Background Sequences with motif | 3.8 |
| Percentage of Background Sequences with motif | 2.42% |
| Average Position of motif in Targets | 159.1 +/- 82.1bp |
| Average Position of motif in Background | 213.9 +/- 81.0bp |
| Strand Bias (log2 ratio + to - strand density) | -0.6 |
| Multiplicity (# of sites on avg that occur together) | 1.07 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
EGL-5(Homeobox)/cElegans-L3-EGL5-ChIP-Seq(modEncode)/Homer
| Match Rank: | 1 |
| Score: | 0.82 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CCACTAAA- CCCATTAAAT |
|

|
|
zen/dmmpmm(SeSiMCMC)/fly
| Match Rank: | 2 |
| Score: | 0.78 |
| Offset: | 1 |
| Orientation: | reverse strand |
| Alignment: | CCACTAAA -CATTAAA |
|

|
|
MA0193.1_Lag1/Jaspar
| Match Rank: | 3 |
| Score: | 0.78 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CCACTAAA CTACCAA- |
|

|
|
PH0057.1_Hoxb13/Jaspar
| Match Rank: | 4 |
| Score: | 0.74 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CCACTAAA----- AACCCAATAAAATTCG |
|

|
|
cad/dmmpmm(Papatsenko)/fly
| Match Rank: | 5 |
| Score: | 0.73 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CCACTAAA- CCATAAAAA |
|

|
|
MA0151.1_ARID3A/Jaspar
| Match Rank: | 6 |
| Score: | 0.72 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | CCACTAAA --ATTAAA |
|

|
|
PHO2(MacIsaac)/Yeast
| Match Rank: | 7 |
| Score: | 0.72 |
| Offset: | 2 |
| Orientation: | forward strand |
| Alignment: | CCACTAAA --ATTAAG |
|

|
|
PB0048.1_Nkx3-1_1/Jaspar
| Match Rank: | 8 |
| Score: | 0.72 |
| Offset: | -5 |
| Orientation: | forward strand |
| Alignment: | -----CCACTAAA---- CTTAACCACTTAAGGAT |
|

|
|
PH0078.1_Hoxd13/Jaspar
| Match Rank: | 9 |
| Score: | 0.71 |
| Offset: | -3 |
| Orientation: | forward strand |
| Alignment: | ---CCACTAAA----- CTACCAATAAAATTCT |
|

|
|
MA0343.1_NDT80/Jaspar
| Match Rank: | 10 |
| Score: | 0.71 |
| Offset: | -7 |
| Orientation: | forward strand |
| Alignment: | -------CCACTAAA------ TTTCCGGCCACAAAAACGCAA |
|

|
|