| p-value: | 1e-9 |
| log p-value: | -2.135e+01 |
| Information Content per bp: | 1.620 |
| Number of Target Sequences with motif | 57.0 |
| Percentage of Target Sequences with motif | 9.18% |
| Number of Background Sequences with motif | 13.2 |
| Percentage of Background Sequences with motif | 3.74% |
| Average Position of motif in Targets | 146.2 +/- 83.4bp |
| Average Position of motif in Background | 150.5 +/- 75.6bp |
| Strand Bias (log2 ratio + to - strand density) | 0.0 |
| Multiplicity (# of sites on avg that occur together) | 1.07 |
| Motif File: | file (matrix) reverse opposite |
| PDF Format Logos: | forward logo reverse opposite |
MA0379.1_SIG1/Jaspar
| Match Rank: | 1 |
| Score: | 0.88 |
| Offset: | 3 |
| Orientation: | forward strand |
| Alignment: | CCTATATA ---ATATA |
|

|
|
TATA-box/SacCer-Promoters/Homer
| Match Rank: | 2 |
| Score: | 0.86 |
| Offset: | 2 |
| Orientation: | reverse strand |
| Alignment: | CCTATATA---- --TATATAWDVV |
|

|
|
PB0163.1_Six6_2/Jaspar
| Match Rank: | 3 |
| Score: | 0.78 |
| Offset: | -2 |
| Orientation: | forward strand |
| Alignment: | --CCTATATA------- ATGGGATATATCCGCCT |
|

|
|
TBP(- other)/several species/AthaMap
| Match Rank: | 4 |
| Score: | 0.77 |
| Offset: | 0 |
| Orientation: | forward strand |
| Alignment: | CCTATATA---- ACTATAAATACC |
|

|
|
Cf2/dmmpmm(Bergman)/fly
| Match Rank: | 5 |
| Score: | 0.76 |
| Offset: | 0 |
| Orientation: | reverse strand |
| Alignment: | CCTATATA- TATATATAC |
|

|
|
MA0015.1_Cf2_II/Jaspar
| Match Rank: | 6 |
| Score: | 0.75 |
| Offset: | -1 |
| Orientation: | reverse strand |
| Alignment: | -CCTATATA- NTATATATAC |
|

|
|
MA0345.1_NHP6A/Jaspar
| Match Rank: | 7 |
| Score: | 0.75 |
| Offset: | -6 |
| Orientation: | forward strand |
| Alignment: | ------CCTATATA------- ATGACCTATATATAAAAATGA |
|

|
|
MA0108.2_TBP/Jaspar
| Match Rank: | 8 |
| Score: | 0.74 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------CCTATATA- NNNNNNCTTTTATAN |
|

|
|
POL012.1_TATA-Box/Jaspar
| Match Rank: | 9 |
| Score: | 0.74 |
| Offset: | -6 |
| Orientation: | reverse strand |
| Alignment: | ------CCTATATA- NNNNNNCTTTTATAN |
|

|
|
MA0346.1_NHP6B/Jaspar
| Match Rank: | 10 |
| Score: | 0.72 |
| Offset: | -4 |
| Orientation: | forward strand |
| Alignment: | ----CCTATATA-------- TTTATTTATATATAATATGA |
|

|
|